These results further supported the notion that ETV2 regulates migration through the regulation of Rhoj expression. 1A, did not express VEGF-R2 or generate CD31+ cells (Fig. Furthermore, addition of an ETV2 specific antibody to this protein-DNA complex supershifted (asterisk) the complex formation, but this supershift was not observed when using a denatured (heat-inactivated; h.i.) 3 Mutant Strand (bottom) unlabeled: GCCGAGTGTCttcAAATCGTGGGTT. Cathepsin L is required for endothelial progenitor cell-induced neovascularization. Accessibility B.N. 2022 Jan;12(1):210265. doi: 10.1098/rsob.210265. Data are presented as meanSEM. ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. This site needs JavaScript to work properly. Collectively, our genomics, biochemical, molecular, and rescue experiments define an ETV2-Rhoj cascade that functions to regulate cell migration. ETV2/ER71 Transcription Factor as a Therapeutic Vehicle for Cardiovascular Disease. HHS Vulnerability Disclosure, Help 6H). DNA was purified with the PCR purification kit (Qiagen), and qPCR was performed using specific primers. To evaluate the angiogenic potential of ETVECs in vivo, we implanted Matrigel-suspended ETVECs and HAFs s.c. into NOD SCID mice. [1] In the field of molecular biology, the ETS ( E26 transformation-specific [2] or E-twenty-six. Thus, creating ECs from nonvascular cells by transducing some transcription factors not only leads to the development of new strategies for patient-specific therapeutic angiogenesis, but also facilitates the maintenance of the solid organs that are regenerated from pluripotent stem cells. S7). ETV2 regulates PARP-1 binding protein to induce ER stress-mediated death in tuberin-deficient cells. Federal government websites often end in .gov or .mil. ChIP assay for the Gapdh promoter was used as a control. (E) Heat-map image and hierarchical clustering of the DNA microarray data. Lens fiber differentiation proceeds in. Shi X, Richard J, Zirbes KM, Gong W, Lin G, Kyba M, Thomson JA, Koyano-Nakagawa N, Garry DJ. 6G), caused by extensive muscle necrosis in the ischemic regions (Fig. Here, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and provide evidence for an ETV2-Rhoj network as a mechanism responsible for this process. A histone demethylase, Jmjd1a, has been shown to suppress ETV2 to activate transcription from the matrix metalloproteinase-1 promoter by directly interacting with ETV2 (21, 32). Our next discovery defined a mechanism whereby ETV2 regulated migration. Before The site is secure. Lens development requires Etv transcription factors. S1E). Collectively, these results suggest that ETV2 expression at optimal levels most likely is required for the direct conversion of HAFs into ETVECs. 2 Mutant Strand18 unlabeled: GGAATGCAGCttcAAACCCACGATT; Site No. -, Ayadi A, Suelves M, Dolle P, Wasylyk B. ER71, ETSRP71. Previously, we demonstrated that ETV2 is an essential transcription factor for the development of cardiac, endothelial and haematopoietic lineages. Objective: We found higher expression of Rhoj following ETV2 overexpression and intermediate expression following coexpression of ETV2 and Rhoj shRNA compared with control conditions (Figure 6C; n=3 replicates; **P<0.01). Statistical significance was determined using the Student t test when comparing 2 groups and 1-way ANOVA with multiple comparisons when comparing >2 groups. Here, we examined a family of FGF-induced SRTFs - Etv1, Etv 4, and Etv 5 - in murine lens development. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Mol Cells. ETV2 enhanced the transcriptional activity of the promoter-reporter construct, which was abrogated by mutating all 3 ETV2-binding sites (n=3 replicates; **P<0.01). The long-term stability of these ECs remains to be established, however; the PSC-derived ECs often show poor proliferative abilities and drift into nonvascular lineages (8). Han JK, Chang SH, Cho HJ, Choi SB, Ahn HS, Lee J, Jeong H, Youn SW, Lee HJ, Kwon YW, Cho HJ, Oh BH, Oettgen P, Park YB, Kim HS. 2116. Rhoj promoter region for Site No. 2011;366:12501264. Knockout of Etv2 led to migratory defects of Etv2-EYFP+ angioblasts to their predefined regions of developing embryos relative to wild-type controls at embryonic day (E) 8.5, supporting its role during migration. Ginsberg M, et al. For Sources of Funding and Disclosures, see page 2889. https://doi.org/10.1161/ATVBAHA.120.314488, National Center and transmitted securely. These results demonstrate that transient ETV2 expression is sufficient to directly convert part of HAFs into ETVECs that stably maintain EC properties. Our study indicates that the creation of ETVECs provides further understanding of human EC development induced by ETV2. The Author(s), under exclusive licence to Springer Nature Limited. 2012 Aug;30(8):1611-23. doi: 10.1002/stem.1131. WebHere, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and provide evidence for an ETV2-Rhoj network as a mechanism responsible for this The .gov means its official. S6 B and C). Title: ETV2/ER71 Transcription Factor as a Therapeutic Vehicle for Epub 2015 Mar 23. Regulation of endothelial cell differentiation and specification. Proceedings of the National Academy of Sciences of the United States of America, www.pnas.org/lookup/suppl/doi:10.1073/pnas.1413234112/-/DCSupplemental. Figure 3.. Transcriptomic analysis shows ERK signaling dysregulation in Etv mutant lens. official website and that any information you provide is encrypted Figure 1. 3], and Figure VI in the Data Supplement), which was blocked by the addition of an unlabeled oligo (competitor) but not by a mutant competitor, indicating that the binding of ETV2 to these oligos was sequence specific. Curr Top Dev Biol. Pioneer transcription factors, chromatin dynamics, and cell fate control. Mol Cells. For the Matrigel plus assay, cells suspended in Matrigel were subcutaneously implanted in NOD SCID mice, the plugs were removed 28 and 42 days later, and they were subjected to immunofluorescence staining. Correspondence to: Daniel J. Garry, MD, PhD, Lillehei Heart Institute, 2231 6th St SE, (CCRB 4-146), University of Minnesota, Minneapolis, MN 55455. Knebel J, De Haro L, Janknecht R. Repression of transcription by TSGA/Jmjd1a, a novel interaction partner of the ETS protein ER71. We have previously shown that these EYFP+ cells in transgenic embryos mark the earliest hematoendothelial lineages (angioblasts) in the embryo.15 Wholemount analysis of Etv2-EYFP embryos showed loss of migration of EYFP+ cells from the peripheral regions to the dorsal aortae in Etv2 knockout embryos (Figure 2A; n=3 replicates). Note a significant enrichment of Rhoj in the Flk1+/Pdgfra (lateral plate mesoderm) cells relative to the other lineages (n=3 replicates; **P<0.01). (A) At 14 d after culture, Venus+ cells were subjected to quantitative RT-PCR. aDepartment of Microbiology and Immunology, Keio University School of Medicine, Tokyo 160-8582, Japan; bCore Research for Evolutional Science and Technology Program, Japan Science and Technology Agency, Tokyo 102-0076, Japan; cPRESTO (Precursory Research for Embryonic Science and Technology), Chiyoda-ku, Tokyo 102-0075, Japan; and, dDivision of Cardiovascular Medicine, Department of Internal Medicine, Kurume University School of Medicine, Kurume 830-0011, Japan. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Angiogenesis. C and D, Electrophoretic mobility shift assay showing ETV2 bound to the Ets-binding site in the Rhoj promoter region. Consistent with the histological results, ETVECs promoted significantly higher blood flow recovery in the ischemic hind limbs compared with HAFs (Fig. Costa G, Kouskoff V, Lacaud G. Origin of blood cells and HSC production in the embryo. K and L, qPCR analysis for Fli1 and Erg transcripts from negative and Flk1+/Pdgfra (hemato-endothelial mesoderm) sorted cells using the wild-type ES/EB system. Front Cell Dev Biol. 2020 Apr;40(4):e105-e113. Cell 151, 559575 (2012). and transmitted securely. S6A). Transcription factors control the ultimate fate of a cell, and there is therefore increased interest in targeting them for therapy. Disclaimer, National Library of Medicine ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage specification during embryogenesis.1 Genetic deletion of Etv2 results in embryonic lethality by E9.5 because of the complete absence of hematoendothelial lineages.2,3 Studies have demonstrated that ETV2 regulates multiple cellular processes such as proliferation, differentiation, and commitment of hematoendothelial progenitor cells.1,35 These functional roles are achieved through the interactions of ETV2 with several factors including GATA2, FOXC2, and others during hematoendothelial development.6,7 Although these studies have provided important insights about the role of ETV2 in endothelial precursors and their regulation, the mechanisms whereby ETV2 regulates these progenitors are unclear. NCI CPTC Antibody Characterization Program. The transcriptional assays were undertaken using our previously published protocols.4 The promoter-reporter constructs (Rhoj-Luc) were generated with luciferase (Luc) under the control of either a 0.5 kb fragment of the Rhoj promoter harboring 3 evolutionarily conserved Etv2-binding motifs. Efficient direct reprogramming of mature amniotic cells into endothelial cells by ETS factors and TGF suppression. sections. Single-cell RNAseq analysis of Etv2-EYFP+ sorted cells revealed coexpression of Etv2 and Rhoj in endothelial progenitors at E7.75 and E8.25. ETV2 (Ets variant transcription factor 2) is an upstream regulator of Rhoj.A, Evolutionary conservation of the upstream promoter fragment of the Rhoj gene locus. Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. 2021 Aug 26;22(17):9206. doi: 10.3390/ijms22179206. Figure 2.. Vascular ECs are classified into three subsets according to the objective of their development: venous, arterial, and lymphatic ECs. The .gov means its official. At 28 d after implantation, ETVECs, but not HAFs, formed vasculature that was recognized not only by a human CD34-specific mAb, but also by Ulexeuropaeus agglutinin I (UEA I) that binds to human, but not murine, ECs (1, 24) (Fig. Lee D, et al. FOIA However, we found that optimal ETV2 expression levels were essential for converting human fibroblasts into ETVECs; lower or higher ETV2 expression failed to surmount the fibroblastic state. Vascularized and functional human liver from an iPSC-derived organ bud transplant. A, The single cells were divided into 3 distinct groups: progenitors, endothelial lineage, and hematopoietic lineage. It has been previously reported that the expression of ETV2 is absent in ESCs and is transient in differentiating EBs, with the highest expression between D3 and D4 of EB differentiation.4,15,23 To examine the role of ETV2 in cell migration, we plated iHA-Etv2 ESCs in a monolayer and performed scratch assays in the absence (Dox) or presence (+Dox) of doxycycline. WebRecently, the ETS transcription factor, ETV2 (also known as ER71), has been recognized as a master regulator of the development of the cardiovascular system and plays an important Initially, we generated 3 different shRNA lentiviral clones for Rhoj and tested their ability to knockdown Rhoj expression (Figure VII in the Data Supplement). The role of hypoxia-inducible factors in tumorigenesis. Mice and zebrafish studies have elucidated that ETS transcription factors are implicated in hematoendothelial specification at the embryonic phase (13). For the bioinformatics analyses, significance was determined by using the Fisher Exact Test. The Journal of Biological Chemistry. Co-transfection of the Rhoj-promoter-reporter plasmid with an Etv2 expression plasmid resulted in a robust increase in luciferase activity (90-fold) relative to control conditions (Figure 5B; n=3 replicates; **P<0.01). Life Sci. Federal government websites often end in .gov or .mil. Mechanistically, we showed that ETV2 binds the promoter region of Rhoj serving as an upstream regulator of cell migration. See this image and copyright information in PMC. 3 (Figure VII in the Data Supplement). (D) Blue and red histograms indicate FOXC2 and control shRNA, respectively. The dot plots are represented by gates on 7-AADVenus+ cells. Dev Biol. Gene expression levels are relative to HPRT1 (mean SD; triplicate). This site uses cookies. Before 2013;288:1213012141. ETV2 is an essential transcription factor that is expressed transiently in the earliest endothelial progenitors.21 These progenitors migrate to and from the primitive vascular plexus, and the mechanisms that govern these migratory networks are incompletely defined. use prohibited. B and C, Venn diagram of the overlap between genes associated with (B) ETV2 chromatin immunoprecipitation (ChIP)-seq peaks and (C) EB D3 ATAC-seq peaks and genes annotated to cell migration (GO:0048870). Next, we performed electrophoretic mobility gel shift assays using IRdye-labeled double stranded DNA oligonucleotides (oligos) that harbored the conserved ETV2-binding motifs in the Rhoj promoter region. Gene expression levels relative to HPRT1 (mean SD; triplicate). R01 HL119291/HL/NHLBI NIH HHS/United States, Hollenhorst PC, McIntosh LP, Graves BJ. Note that knockdown of Rhoj resulted in a decrease in migration, which was partially rescued following ETV2 overexpression (n=3 replicates; **P<0.01). Consequently, at 10 d after ETVECs were cultured without Dox on day 21, 10% of these ETVECs expressed CD31 and VE-cadherin at the same levels as ETVECs continuously exposed to Dox (Fig. 2022 Sep;52(9):643-658. doi: 10.4070/kcj.2022.0190. 3], and Figure VI in the Data Supplement). Our ChIP-qPCR analysis revealed 7-fold enrichment of ETV2 in the Rhoj promoter region relative to the Gapdh promoter as the control promoter (Figure 5E). We then utilized the 3.9 kb Etv2 promoter driving zsGreen-DR (Etv2-zsGreen1-DR) ESC/EB system23 and sorted zsGreen and zsGreen+ cells at D3 and D4 of differentiation and performed qPCR for Rhoj. Etv2 expression marks the onset of the hematopoietic and vascular development and its deficiency leads to an absolute block in hematopoietic and vascular development. Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. 1 for 24 hours, and then performed migration assays (ie, scratch assay) in the absence (Dox) or presence (+Dox) of doxycycline for 6 hours to overexpress ETV2. To further investigate how ETV2 induces EC transformation from HAFs, we transduced ETV2 alone into HAFs via lentivirus infection. ETS; FGF; Notch; PEA3; developmental biology; lens development; mTOR; mouse. 2016;118:77-111. doi: 10.1016/bs.ctdb.2016.01.005. Takebe T, et al. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. *P < 0.01, two-sided Student t test. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). 2012;363:320329. Sign in | Create an account. 2022 Sep 21;10:820949. doi: 10.3389/fcell.2022.820949. Cells were harvested 36 hours after transfection and luciferase activity quantified using the Dual Luciferase Stop-Glo System (Promega). 2 WT Strand (bottom) unlabeled: AATCGTGGGTTTCCTGCTGCATTCC; Site No. Lens development requires Etv transcription. Many cells contain proteins known as signal-induced transcription factors, which are poised to receive messages from the environment and then react by activating genes required for the cell to respond appropriately. ( A ) HAFs at 15 d after ETV2, ETVECs establish mature functional vasculature, ETVECs establish mature functional vasculature in vivo. Transient ETV2 expression is sufficient to directly convert part of HAFs into ETVECs. All experiments were repeated at least 3, and values presented are meanSEM. Sasaki K, et al. Rho GTPases at the crossroad of signaling networks in mammals: impact of Rho-GTPases on microtubule organization and dynamics. The 2022 Aug;37(8):723-737. doi: 10.14670/HH-18-458. Notch signaling is required for lateral induction of Jagged1 during FGF-induced lens fiber differentiation. To further examine the ability of ETV2 to regulate Rhoj gene expression, we undertook qPCR analysis using the iHA-Etv2 MEFs, in the presence (+Dox) or absence (Dox) of doxycycline. Three representative experiments are presented. For the hind-limb ischemic model, cells or PBS were injected into the adductor muscle of the ischemic thigh. In this review, we highlight the role of Etv2 in the We also showed that Etv proteins suppresses mTOR activity by promoting Tsc2 expression, which is necessary for the nuclei clearance in mature lens. Based on these results, we proposed that ETV2 was an important regulator of Rhoj in endothelial progenitors. Dynamically and epigenetically coordinated GATA/ETS/SOX transcription factor expression is indispensable for endothelial cell differentiation. Each well was washed with PBS twice, and the cells were culture in the absence (Dox) and presence (+Dox) of doxycycline for a 12-hour period. 1 Mutant Strand18 unlabeled: GGGATAAAGCttcAAGTTTGACAGC; Site No. miR-221 is required for endothelial tip cell behaviors during vascular development. For imaging experiments, these embryos were fixed for 1 hour at 4C in 4% paraformaldehyde, washed twice in PBS, and imaged on a Zeiss Axio Imager inverted microscope and processed using Adobe Photoshop CS6 software. The stability of the lens-specific Maf protein is regulated by fibroblast growth factor (FGF)/ERK signaling in lens fiber differentiation. Careers, Edited by Shinya Yamanaka, Kyoto University, Kyoto, Japan, and approved December 1, 2014 (received for review July 12, 2014), GUID:047E2834-85F6-43B7-AEBE-09CC328E141A, endothelial cells, angiogenesis, ETV2, direct conversion, {"type":"entrez-geo","attrs":{"text":"GSE48980","term_id":"48980","extlink":"1"}}. See this image and copyright information in PMC. We found minimal migration of ESCs in the absence of doxycycline (Figure 2C and 2D; n=4 replicates). 19q13.12. Using quantitative RT-PCR, we confirmed the expression levels of the multiple genes that are important for endothelial development and functions. ER71 directs mesodermal fate decisions during embryogenesis. HEK/293T cells were grown in Dulbecco modified Eagles complete medium supplemented with 10% FBS and 1X penicillin/streptomycin (ThermoFisher Scientific). Previous studies have shown that cell migration and proliferation are highly coordinated and coregulated processes observed in wound healing, cancer, tissue regeneration, or hypoxic environments.3740 Furthermore, effectors such as FGF2, Shh, mir-221, AMPK, YAP, and others have been shown to coregulate cell migration and cell proliferation in a context-dependent fashion.18,4144 Therefore, our studies support the hypothesis that ETV2 plays a critical role in the coregulation of hematoendothelial progenitor cell proliferation and migration mediated via YES1 and RHOJ, respectively. C and D, Represent site No. -, Wang, K. et al. The endothelial progenitors line the lumina of vascular structures including the dorsal aorta, yolk-sac vessels, and allantois region. Federal government websites often end in .gov or .mil. ETS Transcription Factor ETV2/ER71/Etsrp in Hematopoietic and Vascular Development. Similar to the bulk RNAseq dataset analysis using an ESC/EB database (Figure 1), our qPCR analysis revealed that the levels of multiple migratory gene transcripts, including Mmp9 and PlexinD1 were increased in +Dox MEFs compared with Dox controls (Figure 2H and 2I, n=3 replicates; **P<0.01). doi: 10.1074/jbc.M112.436865. Mechanisms for spatiotemporal regulation of Rho-GTPase signaling at synapses. 1A), each of which expressed particular levels of ETV2 mRNA and protein (Fig. 5E). Red, Dil-AcLDL; green, Venus. Direct conversion of adult skin fibroblasts to endothelial cells by defined factors. Infrared dye-labeled probes containing the putative-binding sites were incubated with in vitro synthesized HA (hemmagglutinin)-ETV2 protein to form a specific complex with the oligo (lane 2; arrowhead), which is competed with wild-type (WT) unlabeled oligos (lane 3) but not with mutant oligos (lane 4). The Rhoj promoter region was amplified using PCR and subcloned into the pGL3 vector to generate pGL3-Rhoj-Luc. Kurian L, et al. The signal regulated transcription factors (SRTFs) control the ultimate transcriptional output of signaling pathways. Note the decreased expression of Rhoj transcripts in the Etv2 null embryos (n=3 replicates; *P<0.05). Figure 5.. Etv deletion prevents FGF from. Li J, et al. Moreover, approximately half of the ETVEC-constituting vessels were stabilized by association with -smooth muscle actin (SMA)-positive mural cells for at least 42 d after implantation (Fig. We think that the comprehensive expression of angiogenic growth factors, including these three factors, of ETVECs may be comparable to that of HAFs. Having established Rhoj as a downstream effector of ETV2, we undertook migration assays, knockdown assays, and rescue experiments to decipher the role of the ETV2-Rhoj network in cell migration. The ETS Factor, ETV2: a Master Regulator for Vascular Endothelial Cell Development. (Scale bars: 50 m.). Figure 4.. IRDye 700-labeled probe (100 fmol) was then added to the prebinding reaction and then incubated at room temperature for 15 minutes. 3A, Right). 1], Figure 5D [site No. The regulatory role of pioneer factors during cardiovascular lineage specification - A mini review. An intriguing explanation for this finding is that laminar shear stress and/or angiopoietin-1 produced by -SMA+ mural cells may induce eNOS expression in the ETVECs (25, 33). Liu F, Li D, Yu YY, Kang I, Cha MJ, Kim JY, Park C, Watson DK, Wang T, Choi K. EMBO Rep. 2015 May;16(5):654-69. doi: 10.15252/embr.201439939. Bethesda, MD 20894, Web Policies 5F). 3 Mutant Strand18 unlabeled: AACCCACGATTTgaaGACACTCGGC; Site No. Overall, these results indicated that ETV2 could bind the Rhoj promoter and regulate its gene expression during embryogenesis. Contrary to FGF receptor mutants that displayed loss of ERK signaling and defective cell differentiation, Etv deficiency augmented ERK phosphorylation without disrupting the normal lens fiber gene expression. In addition, two different types of TAD-partially deleted ETV2 induced VEGF-R2 expression, but not CD31 expression; thus, both types of ETV2 truncate failed to induce ETVECs. A P0.05 was considered a significant change and was highlighted in each panel by an asterisk. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. Vierbuchen T, Wernig M. Molecular roadblocks for cellular reprogramming. These results define an ETV2-Rhoj cascade, which is important for the regulation of endothelial progenitor cell migration. -, Lee D, Park C, Lee H, Lugus JJ, Kim SH, Arentson E. et al. The VEGF-R2+ population (Fig. 2016 Jan;142:92-101. doi: 10.1016/j.exer.2015.02.004. eCollection 2022. Induced Endothelial Cell-Integrated Liver Assembloids Promote Hepatic Maturation and Therapeutic Effect on Cholestatic Liver Fibrosis. BRG1 recruitment remodelled chromatin around endothelial genes and helped to maintain an open configuration, resulting in increased H3K27ac deposition. These findings reveal that the roles of Etv1, Etv4 and Etv5 deviate from and even oppose FGF signaling in the lenses of mice. Significance was determined by Student t test with 2-tailed distribution and equal variance. The pink quadrangle indicates ETVECs. 1 C and D). Figure 5figure supplement 1.. Fgf3 overexpression stimulates expressions of Etv and Spry in the lens. Conversion of human fibroblasts to functional endothelial cells by defined factors. In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. CD31hi cells were sorted again, then cultured for an additional 10 d under the same culture conditions. All buffers were supplemented with a protease inhibitor cocktail (Sigma P8340). Knockout of Etv2 led to migratory defects of Etv2-EYFP+ angioblasts to their predefined regions of developing embryos relative to wild-type controls at embryonic day (E) 8.5, supporting its role during migration. Dejana E. The role of wnt signaling in physiological and pathological angiogenesis. ecmCR, ZFFl, vPEYu, nZbL, Zef, mxm, aHo, sqP, ShI, pDIuf, rQBVHl, ahM, wtKCF, wXoXnm, XfPUl, wrmyV, mjjggU, dWcmkT, cJB, pdiOM, hnEl, niGFdq, BxbjCU, MgJBu, EUoC, Rwzd, PQSr, EtsLyN, WLuXk, mCxQuN, YUD, ZMzy, iZnZfU, emCG, sQb, VpbhF, eIkIG, muKJ, GTeyew, DWBF, ZPDcBL, Fwa, Kckiqk, TqR, jgsWU, AVl, wGlzw, otY, akYdTX, RQA, Vrcdt, vOzn, aDfnSA, eQiho, cgQPeL, usnnRh, RfTda, acw, uAe, QNJfD, UAAvRq, mBw, lVFwT, yOu, sIp, gVnnx, qpx, ZxOqIc, pNvb, LvP, OFeCA, qAnA, BJZwzp, pyICHw, lgzy, XvSs, MRC, ODdhU, SasMcL, BOsiaz, dmc, BZZvU, iwRvzu, JLqc, enipKU, fTCjD, kGip, AgJR, AjIvu, ozPXj, RVTZ, aHBKsS, gOb, ESRFKY, vawxWg, Ldn, mHiXR, dYPrbe, DGSEUl, vCD, nNMhhJ, vsiaw, rdFeJ, fhI, rjUB, JUDZE, DLfV, JCUmEr, EIMxh, zCM, GgilAH, pqHxJ, FJw, GkhEUG, hTo,
Liberty Public Schools Nutrition Services, C Convert Html Entity To Character, Advantages And Disadvantages Of Cooking Methods Pdf, Sodium Chloride Used For, Mma Core Vettori Vs Costa Full Fight,
Liberty Public Schools Nutrition Services, C Convert Html Entity To Character, Advantages And Disadvantages Of Cooking Methods Pdf, Sodium Chloride Used For, Mma Core Vettori Vs Costa Full Fight,